WormMine: Gene WBGene00037136

• WormBase Gene ID: WBGene00037136
• Gene Name: Cbr-pxn-2
• Sequence Name: CBG17537
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable heme binding activity and peroxidase activity. Predicted to be involved in response to oxidative stress. Is an ortholog of C. elegans pxn-2. In C. elegans, pxn-2 is involved in several processes, including embryonic body morphogenesis; muscle attachment; and regulation of cellular component organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17537.1	CBG17537.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17537	CBG17537		[unknown]

0 RNAi Result

1 Allele

• WBVar00023892

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063201
• Remark: Cbr-pxn-2, ATTCAAACGTCTGAGAGATGGTGATAGGTTCTGGTATGAGAACGACGAGATGTTTTCAAA, WBGene00037136
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region