WormMine: Gene WBGene00037203

• WormBase Gene ID: WBGene00037203
• Gene Name: CBG17632
• Sequence Name: CBG17632
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable NADP binding activity and phosphogluconate dehydrogenase (decarboxylating) activity. Predicted to be involved in pentose-phosphate shunt. Is an ortholog of C. elegans T25B9.9. In C. elegans, T25B9.9 is involved in defense response to Gram-negative bacterium and negative regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17632.1	CBG17632.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17632	CBG17632		[unknown]

0 RNAi Result

8 Allele

• WBVar00004409
• WBVar00125645
• WBVar00125646
• WBVar00125643
• WBVar00125644
• WBVar00125647
• WBVar00125641
• WBVar00125642

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067487
• Remark: CBG17632, TACGCTCAAGGATTCATGCTCCTTGCCGAGACTTCCAAGCAATTCAACTGGGATTTGAAT, WBGene00037203
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region