WormMine: Gene WBGene00037269

• WormBase Gene ID: WBGene00037269
• Gene Name: Cbr-gcy-8
• Sequence Name: CBG17711
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable protein kinase activity. Predicted to be involved in cyclic nucleotide biosynthetic process and intracellular signal transduction. Expressed in AFDL and AFDR. Is an ortholog of C. elegans gcy-8. In C. elegans, gcy-8 is involved in microvillus organization and response to temperature stimulus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17711a.1	CBG17711a.1		[unknown]
Transcript:CBG17711b.1	CBG17711b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17711a	CBG17711a		[unknown]
CDS:CBG17711b	CBG17711b		[unknown]

0 RNAi Result

2 Allele

• WBVar00004534
• WBVar00125692

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

2 Expression Patterns

• Primary Identifier: Expr1053261
• Remark: Cbr-gcy-8, GGTCTTGTGATGTATGAGATAATATTCAGAAGTCTTCCATTCCCAGAGGGAACTAATCAG, WBGene00037269
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr12204
• Remark: Expression tested in C elegans

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region