WormMine: Gene WBGene00037311

• WormBase Gene ID: WBGene00037311
• Gene Name: Cbr-skpo-2
• Sequence Name: CBG17768
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable heme binding activity and peroxidase activity. Predicted to be involved in response to oxidative stress. Is an ortholog of C. elegans skpo-2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17768.1	CBG17768.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17768	CBG17768		[unknown]

0 RNAi Result

5 Allele

• WBVar00024282
• WBVar00024302
• WBVar00024287
• WBVar00024292
• WBVar00024297

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1070118
• Remark: CBG17768, TAACCCAAATCAAGAAAATCACAATGTCCCGAGTACTTTGCGACGCTGGAGAGCACTTCC, WBGene00037311
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region