WormMine: Gene WBGene00037335

• WormBase Gene ID: WBGene00037335
• Gene Name: CBG17800
• Sequence Name: CBG17800
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable galactoside 2-alpha-L-fucosyltransferase activity. Predicted to be involved in carbohydrate metabolic process. Predicted to be located in membrane. Is an ortholog of C. elegans EGAP9.3 and F41D3.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17800.1	CBG17800.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17800	CBG17800		[unknown]

0 RNAi Result

30 Allele

• WBVar00125800
• WBVar00125803
• WBVar00125804
• WBVar00125801
• WBVar00125802
• WBVar00125807
• WBVar00125808
• WBVar00125805
• WBVar00125806
• WBVar00125809
• WBVar00125799
• WBVar00125797
• WBVar00125798
• WBVar00125791
• WBVar00125792
• WBVar00125790
• WBVar00125795
• WBVar00125796
• WBVar00125793
• WBVar00125794
• WBVar00125788
• WBVar00125789
• WBVar00125786
• WBVar00125787
• WBVar00125780
• WBVar00125781
• WBVar00125784
• WBVar00125785
• WBVar00125782
• WBVar00125783

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065114
• Remark: CBG17800, TCGATGACGATTTTTTCCCTGCGAAATGGAATAAATTGGGCATGATGAGCAATAATGGGA, WBGene00037335
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region