WormMine: Gene WBGene00037402

• WormBase Gene ID: WBGene00037402
• Gene Name: Cbr-nra-4
• Sequence Name: CBG17890
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable carbohydrate binding activity. Is an ortholog of C. elegans nra-4. In C. elegans, nra-4 is involved in protein-containing complex assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17890b.1	CBG17890b.1		[unknown]
Transcript:CBG17890a.1	CBG17890a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17890b	CBG17890b		[unknown]
CDS:CBG17890a	CBG17890a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058004
• Remark: Cbr-nra-4, GTACGGAAAGATGAGAGAAATGTCTGCGAACGCTGTGTCCGACGTCCTCATCGAGGCATT, WBGene00037402
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region