WormMine: Gene WBGene00037482

• WormBase Gene ID: WBGene00037482
• Gene Name: CBG17982
• Sequence Name: CBG17982
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in signal transduction. Is an ortholog of C. elegans tag-325.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17982b.1	CBG17982b.1		[unknown]
Transcript:CBG17982a.1	CBG17982a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17982b	CBG17982b		[unknown]
CDS:CBG17982a	CBG17982a		[unknown]

0 RNAi Result

5 Allele

• WBVar00056345
• WBVar00056340
• WBVar00125920
• WBVar00125921
• WBVar00125919

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056572
• Remark: Cbr-tag-325, ATGTCGACTAGTGCAGCTGTGGATGAATCTAGACCTTCAAAAGAAACGATTCTCGAGAAG, WBGene00037482
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region