WormMine: Gene WBGene00037499

• WormBase Gene ID: WBGene00037499
• Gene Name: Cbr-acy-1
• Sequence Name: CBG18000
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in cyclic nucleotide biosynthetic process and intracellular signal transduction. Is an ortholog of C. elegans acy-1. In C. elegans, acy-1 is involved in several processes, including locomotory exploration behavior; memory; and regulation of defecation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18000.1	CBG18000.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18000	CBG18000		[unknown]

0 RNAi Result

1 Allele

• WBVar00024437

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051055
• Remark: Cbr-acy-1, CAAGTATCCCAGCATACCAGAGAATTCCTTTTGGATCGATATGAATTCGAGTTCAGAGAT, WBGene00037499
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region