WormMine: Gene WBGene00037520

• WormBase Gene ID: WBGene00037520
• Gene Name: Cbr-cdka-1
• Sequence Name: CBG18023
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable cyclin-dependent protein serine/threonine kinase activator activity. Predicted to be part of protein kinase 5 complex. Is an ortholog of C. elegans cdka-1. In C. elegans, cdka-1 is involved in GABAergic synaptic transmission; regulation of cellular localization; and synaptic vesicle transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18023a.1	CBG18023a.1		[unknown]
Transcript:CBG18023b.1	CBG18023b.1		[unknown]
Transcript:CBG18023c.1	CBG18023c.1		[unknown]
Transcript:CBG18023d.1	CBG18023d.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18023c	CBG18023c		[unknown]
CDS:CBG18023b	CBG18023b		[unknown]
CDS:CBG18023d	CBG18023d		[unknown]
CDS:CBG18023a	CBG18023a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054338
• Remark: Cbr-cdka-1, GAAGAGCTACACGCATGGATTTTGAGCTGTTTGTATGTTTCTTACTCGTATATGGGTAAC, WBGene00037520
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region