WormMine: Gene WBGene00037528

• WormBase Gene ID: WBGene00037528
• Gene Name: Cbr-asb-1
• Sequence Name: CBG18031
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable proton transmembrane transporter activity. Predicted to be involved in proton motive force-driven ATP synthesis. Predicted to be part of mitochondrial proton-transporting ATP synthase complex, coupling factor F(o). Is an ortholog of C. elegans asb-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18031.1	CBG18031.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18031	CBG18031		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_downregulated
	C.briggsae proteins that showed significantly decreased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_downregulated

1 Expression Patterns

• Primary Identifier: Expr1063104
• Remark: Cbr-asb-1, AGATTTGAACGCGACCAGCTCCTGAAACTCATCAACGAGAGTGTCGAAAAGCAAGTTTCG, WBGene00037528
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region