WormMine: Gene WBGene00037540

• WormBase Gene ID: WBGene00037540
• Gene Name: Cbr-imph-1
• Sequence Name: CBG18043
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable RNA binding activity. Is an ortholog of C. elegans imph-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18043b.1	CBG18043b.1		[unknown]
Transcript:CBG18043a.1	CBG18043a.1		[unknown]
Transcript:CBG18043c.1	CBG18043c.1		[unknown]
Transcript:CBG18043d.1	CBG18043d.1		[unknown]
Transcript:CBG18043e.1	CBG18043e.1		[unknown]
Transcript:CBG18043e.2	CBG18043e.2		[unknown]

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18043e	CBG18043e		[unknown]
CDS:CBG18043d	CBG18043d		[unknown]
CDS:CBG18043a	CBG18043a		[unknown]
CDS:CBG18043c	CBG18043c		[unknown]
CDS:CBG18043b	CBG18043b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063805
• Remark: CBG18043, TGTCGATGGAGGTCCATACAATGTGAAATTGCGTACAGAAGTTTGTGTTCCGACAAAGAT, WBGene00037540
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region