WormMine: Gene WBGene00037639

• WormBase Gene ID: WBGene00037639
• Gene Name: Cbr-zyg-8
• Sequence Name: CBG18173
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Predicted to be involved in intracellular signal transduction. Is an ortholog of C. elegans zyg-8. In C. elegans, zyg-8 is involved in establishment of mitotic spindle localization; negative regulation of microtubule depolymerization; and response to temperature stimulus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18173.2	CBG18173.2		[unknown]
Transcript:CBG18173.1	CBG18173.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18173	CBG18173		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058648
• Remark: Cbr-zyg-8, TGATAATACATTTATAGTTCAACTTTATGATCACTGGTTTGTCGATGATTCCTACTTTCT, WBGene00037639
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region