WormMine: Gene WBGene00037690

• WormBase Gene ID: WBGene00037690
• Gene Name: Cbr-twk-40
• Sequence Name: CBG18237
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable potassium channel activity. Predicted to be involved in potassium ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans twk-40.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18237a.1	CBG18237a.1		[unknown]
Transcript:CBG18237a.3	CBG18237a.3		[unknown]
Transcript:CBG18237a.2	CBG18237a.2		[unknown]
Transcript:CBG18237b.1	CBG18237b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18237a	CBG18237a		[unknown]
CDS:CBG18237b	CBG18237b		[unknown]

0 RNAi Result

7 Allele

• WBVar00138714
• WBVar00138716
• WBVar00138715
• WBVar00138718
• WBVar00138717
• WBVar00138719
• WBVar00126126

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056639
• Remark: Cbr-twk-40, GAAAGTTGGCAGTCGTTATGGTCCATACTAACAGGGAGGACCCAGGAAGTTCATGTTTAA, WBGene00037690
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region