Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG18240.1 | CBG18240.1 | [unknown] |
Other
2 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Heat shock: 34C 30min. | Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. | DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. | WBPaper00058955:heatshock_upregulated_CBG |
C.briggsae proteins that showed significantly decreased at L4 larva stage than in emrbyo. | Benjamin and Hochberg corrected p-value < 0.05. | WBPaper00051425:CB_L4_vs_embryo_downregulated |
3 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CBG13233, ACGCCGATAATCAACCAGGAGTCTCAATTCAAGTATACGAAGGAGAACGAGCCATGACTC, WBGene00034024 | Expr1069406 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
CBG13234, CAGCTCCACGAGGTGTTCCTCAGATTGAAGTCACTTTTGATATCGATGCAAATGGAATTC, WBGene00034025 | Expr1063119 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
CBG18239, GGATTTTCTGGATTCAATTCAAACAACTATCCACAGGGACCAACTGTTGAAGAGGTCGAT, WBGene00037692 | Expr1057766 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |