WormMine: Gene WBGene00037744

• WormBase Gene ID: WBGene00037744
• Gene Name: Cbr-vps-50
• Sequence Name: CBG18297
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be involved in endocytic recycling and retrograde transport, endosome to Golgi. Predicted to be part of EARP complex. Is an ortholog of C. elegans vps-50. In C. elegans, vps-50 is involved in positive regulation of dense core granule transport and positive regulation of locomotion involved in locomotory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18297.1	CBG18297.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18297	CBG18297		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061435
• Remark: CBG18297, GTTATCCTCTTTGTTAGGAGCTGCCGCTCATGTCAGCAAAAAAGCGAGACTTCGGATATT, WBGene00037744
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region