WormMine: Gene WBGene00037751

• WormBase Gene ID: WBGene00037751
• Gene Name: Cbr-sca-1
• Sequence Name: CBG18305
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity; ATP hydrolysis activity; and P-type calcium transporter activity. Predicted to be involved in calcium ion transport. Predicted to be located in membrane. Is an ortholog of C. elegans sca-1. In C. elegans, sca-1 is involved in several processes, including chemical homeostasis; determination of adult lifespan; and response to stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18305b.1	CBG18305b.1		[unknown]
Transcript:CBG18305a.1	CBG18305a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18305a	CBG18305a		[unknown]
CDS:CBG18305b	CBG18305b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059401
• Remark: Cbr-sca-1, CGTGCCATCTACAACAACATGAAACAGTTCATCAGATATCTTATCTCTTCCAACGTCGGA, WBGene00037751
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

7 GO Annotation

0 Homologues

0 Locations

7 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region