WormMine: Gene WBGene00037753

• WormBase Gene ID: WBGene00037753
• Gene Name: Cbr-klp-7
• Sequence Name: CBG18307
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity; microtubule binding activity; and microtubule motor activity. Predicted to be involved in microtubule-based movement. Is an ortholog of C. elegans klp-7. In C. elegans, klp-7 is involved in several processes, including egg-laying behavior; microtubule cytoskeleton organization; and regulation of cell cycle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18307b.1	CBG18307b.1		[unknown]
Transcript:CBG18307a.1	CBG18307a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18307a	CBG18307a		[unknown]
CDS:CBG18307b	CBG18307b		[unknown]

0 RNAi Result

6 Allele

• WBVar00126190
• WBVar00126191
• WBVar00126194
• WBVar00126195
• WBVar00126192
• WBVar00126193

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062101
• Remark: Cbr-klp-7, TGCAATTATTTGTTTTTCTAGTGTCAAAGAGATGGGAACCGATGGAAGTGGTGAAGCGAC, WBGene00037753
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region