WormMine: Gene WBGene00037773

• WormBase Gene ID: WBGene00037773
• Gene Name: Cbr-fmo-5
• Sequence Name: CBG18329
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable N,N-dimethylaniline monooxygenase activity; NADP binding activity; and flavin adenine dinucleotide binding activity. Is an ortholog of C. elegans fmo-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18329.1	CBG18329.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18329	CBG18329		[unknown]

0 RNAi Result

5 Allele

• WBVar00126239
• WBVar00126237
• WBVar00126238
• WBVar00126235
• WBVar00126236

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066789
• Remark: Cbr-fmo-3, CGTGGATAGTCGAAGGCACACAATTCAAGTGGACTTTGTAAACTATATGCATGAGCTGGG, WBGene00037773
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region