WormMine: Gene WBGene00037784

• WormBase Gene ID: WBGene00037784
• Gene Name: CBG18341
• Sequence Name: CBG18341
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans F36H12.9 and R13H9.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18341.6	CBG18341.6		[unknown]
Transcript:CBG18341.5	CBG18341.5		[unknown]
Transcript:CBG18341.2	CBG18341.2		[unknown]
Transcript:CBG18341.1	CBG18341.1		[unknown]
Transcript:CBG18341.4	CBG18341.4		[unknown]
Transcript:CBG18341.3	CBG18341.3		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18341	CBG18341		[unknown]

0 RNAi Result

5 Allele

• WBVar00138727
• WBVar00138726
• WBVar00138729
• WBVar00138728
• WBVar00138730

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066370
• Remark: Cbr-cnt-2, ATGAAAGGAAACCGGTGCCTGAGAGTTCTCGAGATGAAAAAGAACGATTCATCGATCGGA, WBGene00037782
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region