WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00037857 Gene Name  Cbr-plpp-1.1
Sequence Name  ? CBG18435 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be involved in phospholipid metabolic process. Is an ortholog of C. elegans plpp-1.1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG18435a.1 CBG18435a.1   [unknown]
Transcript:CBG18435d.1 CBG18435d.1   [unknown]
Transcript:CBG18435b.1 CBG18435b.1   [unknown]
Transcript:CBG18435c.1 CBG18435c.1   [unknown]
 

Other

4 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG18435d CBG18435d   [unknown]
CDS:CBG18435c CBG18435c   [unknown]
CDS:CBG18435b CBG18435b   [unknown]
CDS:CBG18435a CBG18435a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG18435, AAACATCACTGGTCGGATGTCCTCGTTGGAGCACTAATGGGCAGTGCCATCGGAATATTT, WBGene00037857   Expr1052124 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  involved_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  involved_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region