WormMine: Gene WBGene00037913

• WormBase Gene ID: WBGene00037913
• Gene Name: Cbr-acdh-13
• Sequence Name: CBG18508
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable flavin adenine dinucleotide binding activity and oxidoreductase activity, acting on the CH-CH group of donors. Is an ortholog of C. elegans acdh-13.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18508.1	CBG18508.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18508	CBG18508		[unknown]

0 RNAi Result

9 Allele

• WBVar00045014
• WBVar00045019
• WBVar00045024
• WBVar00045029
• WBVar00126440
• WBVar00126441
• WBVar00126444
• WBVar00126442
• WBVar00126443

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1059967
• Remark: Cbr-gei-9, CCGGAACGAGACAATCGGACTTAAAGGCACAGACATTGGAAGAATCGATATCACAGCTCT, WBGene00037913
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region