Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG18508.1 | CBG18508.1 | [unknown] |
Other
9 Allele
Public Name |
---|
WBVar00045014 |
WBVar00045019 |
WBVar00045024 |
WBVar00045029 |
WBVar00126440 |
WBVar00126441 |
WBVar00126444 |
WBVar00126442 |
WBVar00126443 |
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16. | DESeq2, FDR < 0.05. | WBPaper00059178:Cbr-spr-4(gu163)_downregulated |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Cbr-gei-9, CCGGAACGAGACAATCGGACTTAAAGGCACAGACATTGGAAGAATCGATATCACAGCTCT, WBGene00037913 | Expr1059967 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |