WormMine: Gene WBGene00037922

• WormBase Gene ID: WBGene00037922
• Gene Name: Cbr-cyp-33C9
• Sequence Name: CBG18519
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable heme binding activity; iron ion binding activity; and oxidoreductase activity. Is an ortholog of C. elegans cyp-33C9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18519.1	CBG18519.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18519	CBG18519		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055180
• Remark: Cbr-cyp-33C9, GGTGGGATGCATACGAAGGAGTTCCGAGCGATTTTGAAGAAGCGTCATGGAGAACTATAA, WBGene00037922
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region