WormMine: Gene WBGene00038118

• WormBase Gene ID: WBGene00038118
• Gene Name: Cbr-nkcc-1
• Sequence Name: CBG18756
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable transmembrane transporter activity. Predicted to be involved in monoatomic ion transport and transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans nkcc-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18756b.1	CBG18756b.1		[unknown]
Transcript:CBG18756a.1	CBG18756a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18756a	CBG18756a		[unknown]
CDS:CBG18756b	CBG18756b		[unknown]

0 RNAi Result

15 Allele

• WBVar00037789
• WBVar00037794
• WBVar00037799
• WBVar00037749
• WBVar00037759
• WBVar00037754
• WBVar00037769
• WBVar00037764
• WBVar00037774
• WBVar00037779
• WBVar00037784
• WBVar00126920
• WBVar00126919
• WBVar00126918
• WBVar00126917

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067414
• Remark: Cbr-nkcc-1, GAAAAGGAATGGTCTCCTCATCGCTCTACCTGTCTTGGCTGGAAGTGATGACTCGAAATC, WBGene00038118
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region