WormMine: Gene WBGene00038122

• WormBase Gene ID: WBGene00038122
• Gene Name: CBG18762
• Sequence Name: CBG18762
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable phosphomannomutase activity. Predicted to be involved in GDP-mannose biosynthetic process. Is an ortholog of C. elegans F52B11.2. In C. elegans, F52B11.2 is involved in IRE1-mediated unfolded protein response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18762.1	CBG18762.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18762	CBG18762		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063779
• Remark: CBG18762, ACTGTAGAGGGACCGGAGGACACCAGGAAACAAGTGGAGGCGGTGCTGAATGCAATTTAA, WBGene00038122
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region