WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00038123 Gene Name  Cbr-cfp-1
Sequence Name  ? CBG18764 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be part of Set1C/COMPASS complex. Is an ortholog of C. elegans cfp-1. In C. elegans, cfp-1 is involved in transdifferentiation. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG18764b.1 CBG18764b.1   [unknown]
Transcript:CBG18764a.1 CBG18764a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG18764a CBG18764a   [unknown]
CDS:CBG18764b CBG18764b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG26265, GTATCGTCTGTTAATCCCACCAGCATCCCAACACCATCCCCATCGAAATCTCAGAATTTC, WBGene00087679   Expr1064269 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG18764, GCGACGAAGGATGCCGCACAAAACGCGACCTGTGCCATAAACACCATAAATGGGTCCCAT, WBGene00038123   Expr1056155 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  part_of

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  part_of

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region