WormMine: Gene WBGene00038137

• WormBase Gene ID: WBGene00038137
• Gene Name: Cbr-ima-2
• Sequence Name: CBG18786
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable nuclear import signal receptor activity. Predicted to be involved in protein import into nucleus. Predicted to be located in cytoplasm. Is an ortholog of C. elegans ima-2. In C. elegans, ima-2 is involved in several processes, including meiotic sister chromatid cohesion; mitotic nuclear membrane reassembly; and protein import into nucleus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18786.1	CBG18786.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18786	CBG18786		[unknown]

0 RNAi Result

8 Allele

• WBVar00037277
• WBVar00037272
• WBVar00037282
• WBVar00045572
• WBVar00045567
• WBVar00045582
• WBVar00045577
• WBVar00045562

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061359
• Remark: CBG24181, ACGAGTATTATGAAGGAGTGCTGTTGGTTGATCTCCAATATCATTGCTGGCACTCAGAAA, WBGene00042351
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region