WormMine: Gene WBGene00038144

• WormBase Gene ID: WBGene00038144
• Gene Name: Cbr-gopc-1
• Sequence Name: CBG18798
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to be located in Golgi apparatus. Is an ortholog of C. elegans gopc-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18798d.1	CBG18798d.1		[unknown]
Transcript:CBG18798c.1	CBG18798c.1		[unknown]
Transcript:CBG18798b.1	CBG18798b.1		[unknown]
Transcript:CBG18798a.1	CBG18798a.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18798a	CBG18798a		[unknown]
CDS:CBG18798b	CBG18798b		[unknown]
CDS:CBG18798c	CBG18798c		[unknown]
CDS:CBG18798d	CBG18798d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062644
• Remark: CBG18798, GAAAGAGTCGAAAAGTGGTGCTCTCGAAACATCCGCACGAGGGTTTGGGCATCTCAATTA, WBGene00038144
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region