WormMine: Gene WBGene00038257

• WormBase Gene ID: WBGene00038257
• Gene Name: Cbr-dre-1
• Sequence Name: CBG18961
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable zinc ion binding activity. Is an ortholog of C. elegans dre-1. In C. elegans, dre-1 is involved in several processes, including mesodermal cell migration; nematode larval development; and positive regulation of apoptotic process involved in development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18961b.1	CBG18961b.1		[unknown]
Transcript:CBG18961a.1	CBG18961a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18961b	CBG18961b		[unknown]
CDS:CBG18961a	CBG18961a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055484
• Remark: Cbr-dre-1, AAAGGTCTTCTCGAGGATAATGAAATCTTCCGAAATGCCCAAGCAGGTGTTCTCATTTCG, WBGene00038257
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region