WormMine: Gene WBGene00038324

• WormBase Gene ID: WBGene00038324
• Gene Name: Cbr-unc-68
• Sequence Name: CBG19042
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium ion binding activity and ryanodine-sensitive calcium-release channel activity. Predicted to be involved in calcium ion transmembrane transport and intracellular calcium ion homeostasis. Predicted to be located in membrane. Is an ortholog of C. elegans unc-68. In C. elegans, unc-68 is involved in locomotion; positive regulation of programmed cell death; and protein localization to organelle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19042b.1	CBG19042b.1		[unknown]
Transcript:CBG19042a.1	CBG19042a.1		[unknown]
Transcript:CBG19042c.1	CBG19042c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19042a	CBG19042a		[unknown]
CDS:CBG19042c	CBG19042c		[unknown]
CDS:CBG19042b	CBG19042b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056583
• Remark: Cbr-unc-68, AAACAGAATATACCGGTCAAGAGACCTACGTACGTGAAAAGTACGATAACCGGGATTGGG, WBGene00038324
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

10 GO Annotation

0 Homologues

0 Locations

10 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region