WormMine: Gene WBGene00038395

• WormBase Gene ID: WBGene00038395
• Gene Name: Cbr-twk-11
• Sequence Name: CBG19123
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable potassium channel activity. Predicted to be involved in potassium ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans twk-11.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19123c.1	CBG19123c.1		[unknown]
Transcript:CBG19123a.1	CBG19123a.1		[unknown]
Transcript:CBG19123b.1	CBG19123b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19123a	CBG19123a		[unknown]
CDS:CBG19123b	CBG19123b		[unknown]
CDS:CBG19123c	CBG19123c		[unknown]

0 RNAi Result

13 Allele

• WBVar00127237
• WBVar00127236
• WBVar00127235
• WBVar00127240
• WBVar00127244
• WBVar00127243
• WBVar00127242
• WBVar00127241
• WBVar00127247
• WBVar00127246
• WBVar00127245
• WBVar00127239
• WBVar00127238

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066887
• Remark: Cbr-twk-11, GGTTGTGGCCAGAGAGAGCAAGTCCATTTGCGTCGAGGCACAGTTCATTAAAGAGAAGGA, WBGene00038395
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region