WormMine: Gene WBGene00038403

• WormBase Gene ID: WBGene00038403
• Gene Name: CBG19133
• Sequence Name: CBG19133
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable glutathione hydrolase activity. Predicted to be involved in glutathione catabolic process. Is an ortholog of C. elegans H14N18.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

7 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19133a.1	CBG19133a.1		[unknown]
Transcript:CBG19133b.1	CBG19133b.1		[unknown]
Transcript:CBG19133c.1	CBG19133c.1		[unknown]
Transcript:CBG19133f.1	CBG19133f.1		[unknown]
Transcript:CBG19133g.1	CBG19133g.1		[unknown]
Transcript:CBG19133d.1	CBG19133d.1		[unknown]
Transcript:CBG19133e.1	CBG19133e.1		[unknown]

Other

7 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19133e	CBG19133e		[unknown]
CDS:CBG19133f	CBG19133f		[unknown]
CDS:CBG19133g	CBG19133g		[unknown]
CDS:CBG19133a	CBG19133a		[unknown]
CDS:CBG19133b	CBG19133b		[unknown]
CDS:CBG19133c	CBG19133c		[unknown]
CDS:CBG19133d	CBG19133d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067096
• Remark: CBG19133, ATACAAGCAGAATTTCACAGTGGTCCCACGACAGAAATCAGTTGTTCAGGGTCTCATTTC, WBGene00038403
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region