WormMine: Gene WBGene00038407

• WormBase Gene ID: WBGene00038407
• Gene Name: Cbr-gck-1
• Sequence Name: CBG19139
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ATP binding activity and protein kinase activity. Is an ortholog of C. elegans gck-1. In C. elegans, gck-1 is involved in several processes, including positive regulation of endocytic recycling; regulation of Golgi organization; and regulation of oocyte development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19139c.1	CBG19139c.1		[unknown]
Transcript:CBG19139a.1	CBG19139a.1		[unknown]
Transcript:CBG19139b.1	CBG19139b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19139c	CBG19139c		[unknown]
CDS:CBG19139a	CBG19139a		[unknown]
CDS:CBG19139b	CBG19139b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060123
• Remark: Cbr-gck-1, AATTAAGACATGTCTTCAGAGAGGTCGAAGATTCATGTCCTGGAATATGTAACGAGTTGG, WBGene00038407
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region