WormMine: Gene WBGene00038467

• WormBase Gene ID: WBGene00038467
• Gene Name: Cbr-spl-2
• Sequence Name: CBG19207
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable carbon-carbon lyase activity and pyridoxal phosphate binding activity. Predicted to be involved in carboxylic acid metabolic process. Is an ortholog of C. elegans spl-2. In C. elegans, spl-2 is involved in defense response to Gram-positive bacterium.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19207.1	CBG19207.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19207	CBG19207		[unknown]

0 RNAi Result

2 Allele

• WBVar00138937
• WBVar00127292

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053819
• Remark: Cbr-tag-38, AAATTGCAAGGGCCAAGTGATGTCTGCATTGTGAGTTGGACAACTGATAGTGGAGTTGAA, WBGene00038467
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region