WormMine: Gene WBGene00038510

• WormBase Gene ID: WBGene00038510
• Gene Name: Cbr-coq-6
• Sequence Name: CBG19254
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable 2-octaprenyl-6-methoxyphenol hydroxylase activity and FAD binding activity. Predicted to be involved in ubiquinone biosynthetic process. Is an ortholog of C. elegans coq-6. In C. elegans, coq-6 is involved in ubiquinone biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19254.1	CBG19254.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19254	CBG19254		[unknown]

0 RNAi Result

8 Allele

• WBVar00025834
• WBVar00025854
• WBVar00025839
• WBVar00025824
• WBVar00025859
• WBVar00025844
• WBVar00025829
• WBVar00025849

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1062841
• Remark: Cbr-coq-6, TGGAGATGCAGTACGAGAAGGAGCAGATATCGGAAGCATCACATATCTTCGAGAATACGA, WBGene00038510
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region