WormMine: Gene WBGene00038561

• WormBase Gene ID: WBGene00038561
• Gene Name: Cbr-dop-2
• Sequence Name: CBG19317
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable G protein-coupled receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans dop-2. In C. elegans, dop-2 is involved in several processes, including cellular response to organonitrogen compound; male mating behavior; and regulation of locomotion involved in locomotory behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19317c.1	CBG19317c.1		[unknown]
Transcript:CBG19317a.1	CBG19317a.1		[unknown]
Transcript:CBG19317b.1	CBG19317b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19317b	CBG19317b		[unknown]
CDS:CBG19317a	CBG19317a		[unknown]
CDS:CBG19317c	CBG19317c		[unknown]

0 RNAi Result

2 Allele

• WBVar00026482
• WBVar00026487

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052223
• Remark: Cbr-dop-2, AAATCCGTTTGAATGTCGCTTCTATAACGCCGAATTCTCAATTCTGAGTTCTTTCATTTC, WBGene00038561
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region