WormMine: Gene WBGene00038583

• WormBase Gene ID: WBGene00038583
• Gene Name: Cbr-rbx-1
• Sequence Name: CBG19342
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable zinc ion binding activity. Is an ortholog of C. elegans rbx-1. In C. elegans, rbx-1 is involved in several processes, including negative regulation of intracellular signal transduction; positive regulation of metaphase/anaphase transition of meiotic cell cycle; and sister chromosome movement towards spindle pole involved in meiotic sister chromatid segregation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19342.1	CBG19342.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19342	CBG19342		[unknown]

0 RNAi Result

7 Allele

• WBVar00127393
• WBVar00127392
• WBVar00025914
• WBVar00025899
• WBVar00025904
• WBVar00025909
• WBVar00025894

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065341
• Remark: Cbr-rbx-1, GCAAATCAAGCTGCTGGACTCAAGGAGGAATGTACTGTTGCCTGGGGTAACTGCAATCAT, WBGene00038583
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region