WormMine: Gene WBGene00038599

• WormBase Gene ID: WBGene00038599
• Gene Name: Cbr-sta-2
• Sequence Name: CBG19363
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA binding activity and DNA-binding transcription factor activity. Predicted to be involved in regulation of DNA-templated transcription and signal transduction. Is an ortholog of C. elegans sta-2. In C. elegans, sta-2 is involved in defense response to fungus; positive regulation of antifungal peptide production; and response to wounding.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19363.1	CBG19363.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19363	CBG19363		[unknown]

0 RNAi Result

6 Allele

• WBVar00057269
• WBVar00057274
• WBVar00057259
• WBVar00057264
• WBVar00025979
• WBVar00025984

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062598
• Remark: Cbr-sta-2, GTACTATTCTATTATTGTCAGTCGCCAGCCACCGTCGGTAATTGTTAAATGTGGAGAAGC, WBGene00038599
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region