WormMine: Gene WBGene00038608

• WormBase Gene ID: WBGene00038608
• Gene Name: CBG19373
• Sequence Name: CBG19373
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GTP binding activity; GTPase activity; and translation initiation factor activity. Predicted to be involved in translational initiation. Is an ortholog of C. elegans F46B6.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19373b.2	CBG19373b.2		[unknown]
Transcript:CBG19373b.1	CBG19373b.1		[unknown]
Transcript:CBG19373a.1	CBG19373a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19373b	CBG19373b		[unknown]
CDS:CBG19373a	CBG19373a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057850
• Remark: CBG19373, GATGGAAGTGGTATCGAATGCAAAAACGAACACTGAAGTCGGTCTGGCGCTTTCCGATAA, WBGene00038608
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region