WormMine: Gene WBGene00038633

• WormBase Gene ID: WBGene00038633
• Gene Name: Cbr-mec-9
• Sequence Name: CBG19401
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium ion binding activity and serine-type endopeptidase inhibitor activity. Is an ortholog of C. elegans mec-9. In C. elegans, mec-9 is involved in positive regulation of multicellular organismal process and response to mechanical stimulus.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19401.1	CBG19401.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19401	CBG19401		[unknown]

0 RNAi Result

12 Allele

• WBVar00057454
• WBVar00057459
• WBVar00057464
• WBVar00127427
• WBVar00127426
• WBVar00026044
• WBVar00026029
• WBVar00026049
• WBVar00026034
• WBVar00026019
• WBVar00026039
• WBVar00026024

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052231
• Remark: Cbr-mec-9, AAGAAGAATGGATTGCTCAGATGAGACAAAGACTGAAAGAGACTGGTGGAGGGATTGGTG, WBGene00038633
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region