WormMine: Gene WBGene00038735

• WormBase Gene ID: WBGene00038735
• Gene Name: CBG19535
• Sequence Name: CBG19535
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans sex-1. In C. elegans, sex-1 is involved in primary sex determination and regulation of gene expression.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19535.1	CBG19535.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19535	CBG19535		[unknown]

0 RNAi Result

31 Allele

• WBVar00026812
• WBVar00026877
• WBVar00026942
• WBVar00026817
• WBVar00026882
• WBVar00026947
• WBVar00026822
• WBVar00026887
• WBVar00026952
• WBVar00026827
• WBVar00026892
• WBVar00026957
• WBVar00026832
• WBVar00026897
• WBVar00026837
• WBVar00026902
• WBVar00026842
• WBVar00026907
• WBVar00026972
• WBVar00026847
• WBVar00026977
• WBVar00027042
• WBVar00026852
• WBVar00026982
• WBVar00026857
• WBVar00026987
• WBVar00026862
• WBVar00026867
• WBVar00026807
• WBVar00026872

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057226
• Remark: CBG19535, AAATGCTCGAAAAGTCGTTCCTCGAATTCCTACGCACCGCAGCAAAACAGGGAGATTTGG, WBGene00038735
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region