WormMine: Gene WBGene00038782

• WormBase Gene ID: WBGene00038782
• Gene Name: Cbr-nhr-119
• Sequence Name: CBG19594
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity; sequence-specific DNA binding activity; and zinc ion binding activity. Predicted to be involved in regulation of DNA-templated transcription. Is an ortholog of C. elegans nhr-119.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19594.1	CBG19594.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19594	CBG19594		[unknown]

0 RNAi Result

13 Allele

• WBVar00035549
• WBVar00127592
• WBVar00127591
• WBVar00127590
• WBVar00127596
• WBVar00127595
• WBVar00127594
• WBVar00127593
• WBVar00127599
• WBVar00127598
• WBVar00127597
• WBVar00127589
• WBVar00027177

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060493
• Remark: Cbr-nhr-119, ACCCATCCAAAAGAAGTTGCATCAAGCAGATTCGGAAATCTCCTACTCTTCGTTCCATCC, WBGene00038782
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region