WormMine: Gene WBGene00038848

• WormBase Gene ID: WBGene00038848
• Gene Name: Cbr-mel-32
• Sequence Name: CBG19673
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable glycine hydroxymethyltransferase activity and pyridoxal phosphate binding activity. Predicted to be involved in glycine biosynthetic process from serine and tetrahydrofolate interconversion. Is an ortholog of C. elegans mel-32. In C. elegans, mel-32 is involved in embryo development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19673.1	CBG19673.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19673	CBG19673		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly decreased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_downregulated

1 Expression Patterns

• Primary Identifier: Expr1068898
• Remark: Cbr-mel-32, AGATTCTGAAGAACGCGAAGACGTTGGCTGAGAGATTAAAGAAGCACGGATACTCATTGG, WBGene00038848
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region