WormMine: Gene WBGene00038851

• WormBase Gene ID: WBGene00038851
• Gene Name: Cbr-let-721
• Sequence Name: CBG19676
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable electron-transferring-flavoprotein dehydrogenase activity. Predicted to be involved in electron transport chain. Is an ortholog of C. elegans let-721.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19676.1	CBG19676.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19676	CBG19676		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061352
• Remark: Cbr-let-721, GCAAAACCTGCGACATCAAGGATCCCCAGCAGAACATCAACTGGGTGACACCAGAAGGAG, WBGene00038851
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region