WormMine: Gene WBGene00038863

• WormBase Gene ID: WBGene00038863
• Gene Name: Cbr-nfx-1
• Sequence Name: CBG19688
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity; nucleic acid binding activity; and zinc ion binding activity. Predicted to be located in nucleus. Is an ortholog of C. elegans nfx-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19688.1	CBG19688.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19688	CBG19688		[unknown]

0 RNAi Result

11 Allele

• WBVar00050204
• WBVar00050199
• WBVar00050194
• WBVar00050189
• WBVar00050184
• WBVar00127677
• WBVar00127676
• WBVar00127675
• WBVar00127680
• WBVar00127679
• WBVar00127678

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059239
• Remark: Cbr-tag-182, CATGACTGAGGAGGAAATCGAAGCGGCGAAGCTGATAGAAGAAGGACCAACTTGGGAAGA, WBGene00038863
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region