WormMine: Gene WBGene00038890

• WormBase Gene ID: WBGene00038890
• Gene Name: Cbr-maph-1.1
• Sequence Name: CBG19716
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable microtubule binding activity. Predicted to be involved in microtubule cytoskeleton organization. Predicted to be located in microtubule. Is an ortholog of C. elegans maph-1.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19716a.1	CBG19716a.1		[unknown]
Transcript:CBG19716b.1	CBG19716b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19716b	CBG19716b		[unknown]
CDS:CBG19716a	CBG19716a		[unknown]

0 RNAi Result

8 Allele

• WBVar00127698
• WBVar00127697
• WBVar00028219
• WBVar00028204
• WBVar00028224
• WBVar00028209
• WBVar00028229
• WBVar00028214

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L1 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L1_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1055214
• Remark: CBG19716, TCGAGAAATGTGATTTTGGCATCGAAGGAGATCACTGGAGAACAGTTACAAGCACTGCTT, WBGene00038890
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region