WormMine: Gene WBGene00038965

• WormBase Gene ID: WBGene00038965
• Gene Name: Cbr-ero-1
• Sequence Name: CBG19803
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable FAD binding activity; protein-disulfide reductase activity; and thiol oxidase activity. Predicted to be involved in protein folding in endoplasmic reticulum. Predicted to be located in endoplasmic reticulum. Is an ortholog of C. elegans ero-1. In C. elegans, ero-1 is involved in IRE1-mediated unfolded protein response and protein folding in endoplasmic reticulum.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19803.1	CBG19803.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19803	CBG19803		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062121
• Remark: Cbr-ero-1, TGTTTTCTGATCTACCACATTCACATTATAAACAAGACTCGTCCAGGTTCCAATTGACTA, WBGene00038965
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region