WormMine: Gene WBGene00038970

• WormBase Gene ID: WBGene00038970
• Gene Name: Cbr-ces-2
• Sequence Name: CBG19808
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable DNA-binding transcription factor activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Is an ortholog of C. elegans ces-2. In C. elegans, ces-2 is involved in several processes, including apoptotic process; positive regulation of programmed cell death; and positive regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19808a.1	CBG19808a.1		[unknown]
Transcript:CBG19808b.1	CBG19808b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19808b	CBG19808b		[unknown]
CDS:CBG19808a	CBG19808a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057331
• Remark: Cbr-ces-2, CAAGAAGCCGCCAAACTGCGATTCCTTTTGTTCTCCAAACCATCACCAACGAATTCCGAA, WBGene00038970
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region