WormMine: Gene WBGene00039053

• WormBase Gene ID: WBGene00039053
• Gene Name: Cbr-drp-1
• Sequence Name: CBG19923
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable GTP binding activity and GTPase activity. Is an ortholog of C. elegans drp-1. In C. elegans, drp-1 is involved in apoptotic mitochondrial changes; embryo development; and mitochondrial fission.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19923a.1	CBG19923a.1		[unknown]
Transcript:CBG19923c.1	CBG19923c.1		[unknown]
Transcript:CBG19923b.1	CBG19923b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19923a	CBG19923a		[unknown]
CDS:CBG19923c	CBG19923c		[unknown]
CDS:CBG19923b	CBG19923b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061937
• Remark: Cbr-drp-1, CGCCTACATCAACACAAAGCATCCGGAATTCACAGAGGCCAATCTGGTGACACTTTTGAA, WBGene00039053
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region