WormMine: Gene WBGene00039055

• WormBase Gene ID: WBGene00039055
• Gene Name: Cbr-unc-5
• Sequence Name: CBG19929
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable netrin receptor activity. Predicted to be involved in netrin-activated signaling pathway. Predicted to be located in membrane. Is an ortholog of C. elegans unc-5. In C. elegans, unc-5 is involved in several processes, including axon guidance; regulation of neuron projection development; and sex differentiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19929b.1	CBG19929b.1		[unknown]
Transcript:CBG19929a.1	CBG19929a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19929b	CBG19929b		[unknown]
CDS:CBG19929a	CBG19929a		[unknown]

0 RNAi Result

25 Allele

• WBVar00139053
• WBVar00011259
• WBVar00011254
• WBVar00011264
• WBVar00127901
• WBVar00127905
• WBVar00127904
• WBVar00127903
• WBVar00127902
• WBVar00127909
• WBVar00127908
• WBVar00127907
• WBVar00127906
• WBVar00127921
• WBVar00127920
• WBVar00127912
• WBVar00127911
• WBVar00127910
• WBVar00127916
• WBVar00127915
• WBVar00127914
• WBVar00127913
• WBVar00127919
• WBVar00127918
• WBVar00127917

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056453
• Remark: Cbr-unc-5, GACGCTGTGATGGTTCTAGAAAGATTCTTGTCAGCTTTCCCGCAAATTATTTCTCCCTAG, WBGene00039055
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region