WormMine: Gene WBGene00039154

• WormBase Gene ID: WBGene00039154
• Gene Name: CBG20077
• Sequence Name: CBG20077
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable copper ion transmembrane transporter activity. Predicted to be involved in copper ion transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans F58G6.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20077.1	CBG20077.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20077	CBG20077		[unknown]

0 RNAi Result

2 Allele

• WBVar00128146
• WBVar00128145

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062238
• Remark: CBG20077, TTTCTGGGACCAATGATGACAGTAGAGGAAAGTGAAGCGGCTGGCAGTTGTTGTTCATAA, WBGene00039154
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region